ANALISI GENETICA nei centri Jenevì

L’analisi genetica è un’analisi che si effettua sui geni.

I Geni sono molecole che si trovano all’interno dei cromosomi i quali a loro volta sono contenuti nel nucleo delle cellule.

Ogni cellula umana (per esempio i neuroni del cervello, i fibroblasti del derma ecc.) contengono tra le varie strutture, il nucleo.

All’interno del nucleo si trovano 23 coppie di cromosomi, strutture filamentose che formano bastoncini.

La differenza tra uomo e donna:

  • nell’uomo tra le 23 coppie di cromosomi è presente il cromosoma Y;
  • nella donna è presente il cromosoma X.

All’interno dei cromosomi si trovano appunto i geni.

Questi contengono tutte le informazioni utili alle cellule per lavorare e per sviluppare i caratteri proprio dell’individuo.

Oggi con l’ ANALISI GENETICA siamo in grado di conoscere quasi tutti i geni presenti nella cellula.

Ciascun individuo è unico e diverso dall’altro, tranne che per i gemelli omozigoti che hanno lo stesso corredo genetico.

I geni agiscono come un insieme di istruzioni:

  • controllando la nostra crescita,
  • il funzionamento del nostro corpo e molte delle nostre caratteristiche,
  • come il nostro colore degli occhi,
  • il gruppo sanguigno
  • l’altezza.

I cromosomi li ereditiamo dai nostri genitori, 23 dalla madre e 23 dal padre e questo significa che ciascuno di noi eredita metà dei propri geni dalla madre e metà dal padre che ci porta ad avere caratteri simili dei due genitori.

Il Dna è una sostanza formata da 2 filamenti a forma elicoidale (eliche di DNA) tenute insieme da legami molto forti.

Ciascuna catena è formata dal ripetersi in successione di 4 basi azotate (Adenina, Citosina, Timina, Guanina).

Dobbiamo quindi immaginarci il nostro DNA come un lungo treno composto da 4 tipi di vagoni in successione chiamati A, C, T, G.

Ogni Gene è un pezzetto di questo DNA, costituito da una sequenza determinata di queste basi azotate ed è altamente specifica: per esempio il gene che porta l’informazione della nostra altezza potrebbe essere ACTTCGGAGTCTTCTGGAGT, mentre quello che porta l’informazione del colore degli occhi ATCGGTGACTACG.

L’informazione genetica appena descritta per l’altezza piuttosto che per un altro nostro carattere, verrà riconosciuta all’interno della cellula da altre strutture.

Queste sono gli RNA messaggeri e transfer, che determineranno la formazione di proteine specifiche (codificazione del DNA).

L ANALISI GENETICA_JENEVI_3

Qualche volta succede che c’è l’alterazione di uno di questi geni derivata della sequenza delle basi del DNA “c.d. mutazione”.

L’ ANALISI GENETICA permetterà di individuare questo gene che non sarà più riconosciuto dalle strutture della cellula deputate a trasferire l’informazione in esso contenuta ai meccanismi di creazione di una specifica proteina con la conseguenza che questa mancherà o pur essendo presente, lavorerà male.

Per meglio comprendere questo aspetto, facciamo l’esempio dell’obesità.

Sappiamo che ci sono persone che tendono a ingrassare pur mangiando poco e facendo moderata attività fisica.

Nelle cellule è presente una proteina che serve a far “metabolizzare” i grassi, permettere cioè il loro utilizzo per la produzione di energia.

Se questa proteina manca o non funziona correttamente, i grassi non potendo essere utilizzati o metabolizzati, tenderanno ad accumularsi nelle cellule.

Ebbene se il gene che porta l’informazione per la creazione di questa specifica proteina è alterato, la stessa o non verrà prodotta o se prodotta non funzionerà al meglio portando all’accumulo di grasso nelle cellule.

Altro tipico esempio è l’invecchiamento della pelle.

All’interno delle cellule della pelle (fibroblasti) esistono dei sistemi di difesa dell’ invecchiamento, tra cui i sistemi antiossidanti, costituiti da proteine.

Se una di queste proteine non funzionasse correttamente oppure se fosse assente, i sistemi ossidanti tenderanno a prevalere sui sistemi di difesa e la cellula avrà una vita più breve o sarà danneggiata con il conseguente invecchiamento precoce della pelle.

Con la NGB collabora anche la Clinica Giuridica per l’ analisi forense del dna.

L’ ANALISI GENETICA permetterà di sapere se quello specifico gene è sano o alterato.

Questo permetterà pertanto di conoscere la causa dell’obesità piuttosto che dell’invecchiamento precoce di quell’individuo.

Conoscere i geni dell’invecchiamento sarà utile per mettere in atto misure terapeutiche mirate.

Ad esempio se abbiamo un malfunzionamento dei sistemi che combattono l’ossidazione cellulare, potremmo attuare delle terapie antiossidanti.

Potremo quindi tatuare delle terapia di medicina estetica mirate per esempio al corretto ripristino di alcuni bio-elementi.

L’ ANALISI GENETICA è effettuata sul DNA estratto da un campione prelevato tramite un tampone buccale.

Questo viene strofinato sulla mucosa interna della guancia.

Il prelievo è quindi non invasivo e totalmente indolore.

Il test può essere anche effettuato su campioni biologici quali capelli o saliva.

Vieni a trovarci nei centri di medicina e chirurgia estetica e di analisi genetica a Firenze e Versilia, Milano, Roma, Forte Dei Marmi e Massa.

Potrai eseguire il tuo test genetico e iniziare una terapia dietologica mirata e basata sull’analisi del tuo DNA.

Contatta la segreteria unica al numero 0584787541 o scrivi a medici@jenevi.it

ANALISI GENETICA